vohzd.com
SCP-7712

Cihuateteoh

Series
8
Size
38.0 KB
Views
0

"If you still feel guilt, I release you from it—I forgive you. I love you more than I could ever blame you for leaving me alone."

by Din-Bidor and Kilerpoyo

Item#: 7712

Level3

Containment Class:

keter

Secondary Class:

{$secondary-class}

Disruption Class:

keneq

Risk Class:

danger

link to memo

Special Containment Procedures:

A security perimeter must be maintained around UE-A363, a 26 km2 area surrounding what was once the municipality of Angustias, █████████. Security personnel must discourage any civilians from attempting to access the perimeter. Any third party attempting to access the perimeter without authorization shall be apprehended and handed over to the relevant authorities.

Despite initial concerns, SCP-7712 does not appear to propagate through airborne spores; hence, containment should focus on controlling SCP-7712's mycelium growth. SCP-7712 must not advance within 20 meters of the security perimeter. Sodium chloride, including common table salt, has proven to be a cost-effective solution to contain SCP-7712's growth. Sodium chloride must be constantly poured 10 meters into the perimeter to halt SCP-7712, and it is recommended that personnel maintain a 30-centimeter-wide line of salt along the entire security perimeter.

Security patrols in UE-A363 must be composed of at least 10 elements, wear Level A hazmat suits, and carry, alongside standard firearms, semi-automatic shotguns, salt cartridges, incendiary rounds, and portable flamethrowers. Both salt cartridges and incendiary ammunition have proved to be effective against SCP-7712-2 instances. All SCP-7712-2 instances found within 20 meters of the security perimeter must be terminated immediately. In addition, security personnel must wear safety headphones (filtering frequencies over 10 kHz) at all times.

Any individual coming into direct contact with SCP-7712 or SCP-7712-2 must be immediately quarantined and administered emergency antifungal treatment. If they show any signs of infection after 48 hours, they are to be terminated, and their remains incinerated.

Description:

SCP-7712 refers to a massive fungal overgrowth covering almost the totality of the area designated as UE-A363. Estimates suggest SCP-7712's biomass to be around 120 tons. SCP-7712 has been described, in ecological terms, as a super-decomposer: any external biomass (except bone material), either living or dead, coming in contact with SCP-7712 will be rapidly decomposed and assimilated into the anomaly's biomass.

Containment of SCP-7712 was transferred from CALMECAC to the Foundation after Incident-B33, during which SCP-7712 suddenly and rapidly expanded for a period that lasted approximately 13 minutes and amounted to 85% of its actual size, consuming the entire CALMECAC research facility and all of the personnel, before stabilizing at the current growth rate of 10 cm per day. Prior to this event, CALMECAC had overseen UE-A363 for ten months, starting with the discovery of SCP-7712-1.

SCP-7712 has not been identified as any known fungus species. However, SCP-7712's sporocarp bears a visual resemblance to members of the Chytridiomycota phylum. DNA Sequencing revealed similarities with the following families: Ascomycota (89.1%), Chytridiomycota (8.1%), Basidiomycota (2.8%), and Mucoromycotina (1.3%). In addition, SCP-7712 presents several abnormalities in its genetic code; it appears to have been artificially modified to inhibit spore production. Additionally, an aberrant pattern was subsequently discovered and extracted from SCP-7712's genetic sequences.

AAGGGCGGAATGCTCCGTCTGCGTATGCTCCTTGCGTAAGCGCGTATGCTGCTTATGGCTGATATGCTCTAACTTGTAGGGGGCATGGCGGGCGTCATGGCTCGTGCGCTGGATGACGGCATGAAGGGCGGAATGCTCCGTCTGCGTATGGGACTTTAAGTAGGCGGACGTATGCTTGGAATGGCTGATATGGCTCTTGGAGTTCTTATGGCGGGCGTCATGGCTCGTGCGCTGGATGACGGCATGAAGGGCGGAATGGTTGGCCTGGGCATGGCTGATATGGTCCTTGTAATGGCGGGCGTCATGGCTCGTGCGCTGGATGACGGCATGCGTGTCGATATGCGTGTCGATATGGCGGGCGTCATGGCTCGTGCGCTGGATGACGGCATGGTTGGCCTGCGTATGTAAGGACGTATGCTTGTTCTTGTAGGAGATCTGCGTCTGATGTCAATGGCGGGCATGGGTTAACTTATGGCGCTTATGGTCGATGACTAACTT

Cryptographic analysis revealed the following message:

concadacelulademicuerpolosmaldigoconcadaneuronaenmicerebrolosmaldigocontodalasangredemisvenaslosmaldigocontodamialmalosmaldigoasiasilosmaldigotodaunaeternidadyloquelesigue

Translated from Spanish:

With every cell in my body, I curse them.
With every neuron in my brain, I curse them.
With all the blood in my veins, I curse them.
With my whole soul, I curse them—thus, I curse them for all eternity and beyond.

SCP-7712-2 are humanoid entities encountered within SCP-7712's area. They are made of the same biomass as SCP-7712 and appear to be part of the same fungal network, though they are capable of independent movement. SCP-7712-2 instances are created when SCP-7712 assimilates a human's biomass, replacing it with fungal material. An SCP-7712-2 instance's body grows around the original human bone structure, using it as support. MRI scans have confirmed that SCP-7712-2's internal structures functionally resemble human organs, particularly those related to the nervous system and the brain.

SCP-7712-2 instances behave erratically: sometimes they appear to roam aimlessly, while on other occasions, they will engage in human-like activities mimicking those the original subject would have performed. However, in the proximity of another uninfected human being, they will approach and try to make physical contact. This invariably results in the spread of SCP-7712's infection to a new subject. For this reason, SCP-7712-2 instances must be terminated if in proximity of an uninfected individual.

SCP-7712-1 is a female human body, believed to be the source of SCP-7712. Unlike SCP-7712-2 instances, SCP-7712-1 has only been partially degraded into fungal growth. Approximately 60% of its biomass remains biologically human, while 20% has been replaced by cybernetic implants of unknown purpose, with the rest being fungal in nature. SCP-7712-1 holds in its arms a physically small instance of SCP-7712-2, believed to have originated from the body of a 10-month-old child.

SCP-7712-1 is located inside a warehouse at the center of UE-A363, which was previously used as a research station by CALMECAC. This location has been identified as the neural center of SCP-7712's mycorrhizal network.

Sporadically, SCP-7712-1 will emit an unintelligible vocalization consisting of frequencies above 10.5 kHz. This vocalization will be transferred and amplified through the fungal network and repeated by all SCP-7712-2 instances. Listening to this vocalization can induce acute anxiety, panic attacks, and psychotic episodes in previously healthy individuals. Spectral analysis of this sound has revealed what appears to be phonemes. They have been tentatively reconstructed, following the IPA convention, as aj mis ixos.

CALMECAC/Valravn research logs:

Due to similarities between SCP-7712 and the Valravn Corporation's previous research, CALMECAC hired Valravn biotechnicians to collaborate with the research of SCP-7712. The following logs are from Dr. Centeno, lead Valravn researcher on UE-A363, recovered after Incident-B33:

11/01/23

CALMECAC's initial assessment: "Cruel." Sin Nombre's work, most certainly. Forty-one bodies were piled in the warehouse, burned beyond recognition. There is an outlier: a woman in her late twenties. She was retrieved from the nearby river while holding the body of a child; seems to me like she drowned herself. We have confirmed the unidentified fungal growth to be originating from her brain. The mycelium has extended into her child and – after making contact – the other forty-one corpses.

13/02/23

She is not "dead" in the traditional sense. Her body is rotting at a decelerated rate, but still rotting for sure. This fungus is slowly replacing her tissues, but only partially. This is unlike the other bodies in the warehouse. For example, the child in her arms is almost all fungus at this point. Gross.

03/04/23

Her brainwaves have been confirmed all across the mycorrhizal network. They also correlate with the spasmodic movements we have identified in the other corpses. Is she… trying to move them?

08/05/23

Most likely, this is related to the past lacustrine necroplasmic phenomena we have observed. Water appears to be ontologically correlated to the concept of Death in several cultures. Viking funeral ships. Caronte. Apanohuacalhuia. If this is indeed another incarnation of La Llorona, that would mean good news for the weaponization efforts.

08/06/23

Of course, sporulated reproduction would indeed be a powerful vector to propagate the agent across enemy lines. But it's too difficult to control. I don't want to end up dealing with the Fungus that Hates or some shit. The sporangium has been inhibited for now. Crossbreeding with SPOPPO successfully produced a stable sporeless mutant.

012/07/23

We have discovered that the other bodies work as "nodes" in the networks. She can indeed control them. And with the appropriate gear and interface, we can control her.

13/09/23

Yesterday, one of those things started screaming. We had to send four technicians to cortisol readjustment. This will slightly delay the weaponization protocol, but we are still on track to finish and present it at the next quarterly meeting. Anyways, the psychological warfare applications are as promising as the biological warfare ones.

The last log is dated on the same day as Incident-B33.

01/10/23

We have completed around 80% of the projected modifications. Removing the fungal child has been deemed necessary to complete the remaining 20%. I gave my approval, and the surgery will be at noon. That thing gave me the creeps, anyway.

Update: Incident C24

On November 1st, 2024, at 23:00 hours, all SCP-7712-2 instances suddenly became inert, with some of them partially dissolving and falling to the ground. At 23:30, the total biomass of SCP-7712 began to experience accelerated signs of withering, with most of the fungal biomass perishing by November 2nd, 00:00. At the same time, specimens of tagetes erecta began sprouting from the decaying fungal biomass. By 00:50, most of the UE-A363 area had been covered by tagetes erecta.

Surveillance footage revealed an unidentified male individual, designated as POI-8754, breaching the perimeter at 14:00 hours on November 1st, avoiding both security personnel and roaming SCP-7712-2. The apparent ease with which this individual breached the perimeter undetected and evaded SCP-7712's contamination without the use of protective gear suggests some form of anomalous assistance, though this hypothesis remains unconfirmed.

POI-8754 entered the warehouse at 18:00 hours. It is unclear what happened inside the building, but further analysis of the anomaly's remains revealed SCP-7712-1 and the infant SCP-7712-2 to be missing. Efforts to identify and capture POI-8754 have yielded no results so far. No further anomalous activity has been identified inside UE-A363. SCP-7712's classification has been updated to Neutralized.

A document, presumably written by POI-8754, was recovered inside the warehouse, in the same location as the missing SCP-7712-1.

  • Original Text
  • Translation

¿Te acuerdas, mamá, de cómo era el pueblo antes? Pequeño, sí, pero lleno de vida. En la estación lluviosa, los campos verdes se extendían hasta más allá del horizonte. Las casas de la gente—de paredes blancas y tejas rojas—eran como pecas en el rostro de la tierra fértil, y nosotros como hormigas que trabajan diligentes de sol a sol, cosechando la milpa y arreando vacas y borregos. No teníamos más que eso, pero éramos felices; tan solo el fruto que conseguíamos con la labor de nuestras manos bastaba para saber que habíamos sido bendecidos, para recordar que debíamos ser agradecidos y no olvidar jamás los sacrificios que nuestra sangre había hecho para conseguirnos un poco de tranquilidad en un mundo cada vez más convulso.

Recuerdo que en la casa teníamos un árbol de aguacate, bien grandote y bien frondoso. Me enseñaste a cuidarlo, a darle agua y tierra buena, a recoger sus frutos maduros y a guardar las semillas. Te dije una vez que con tantas semillas podríamos plantar todo un bosque de aguacates, y te reíste con la picardía de una madre que sabe algo que su hijo no. Cuando te pregunté, dijiste que el aguacate chupa toda el agua que hay en la tierra, y que por eso no es bueno sembrar demasiado. “Las otras plantitas también necesitan agua,” dijiste. “Siempre hay que dejar algo para los demás, Jairo, y no abusar. La tierra es buena con nosotros, así que hay que ser buenos con ella, y con quienes también la habitan.”

Así es como fue siempre para nosotros. No cosechábamos más de lo que debíamos, pues dejábamos a la tierra descansar y renovarse. Cuando teníamos más de lo que podíamos comer, lo vendíamos en el mercado, procurando ser justos con el precio y no dejarnos poseer por el mal del dinero. A veces había disputas, sí, pleitos entre vecinos y hasta entre familias, pero nunca olvidábamos quiénes éramos, de dónde habíamos venido y que, hasta el final, seríamos siempre una misma gente, un mismo pueblo.

También había tristeza, claro. Cuando papá murió, lo lloramos cinco meses. Las noches sin sus chistes de los que solo él se reía eran solitarias, largas y pesadas con su ausencia. Las historias que nos contaba estaban como él, sin vida, como ecos apagados que no osábamos repetir para no interrumpirlo en su descanso eterno. Sin él, tuvimos que trabajar el doble en el campo, entregarnos de cuerpo y alma a labrar la tierra. Tú nunca quisiste que yo abandonara mis estudios para ayudarte, pero yo no iba a dejarte todo el trabajo porque Gustavo todavía era un niño de pecho, y tus protestas no encontraron en mí otra respuesta que la más pura testarudez. “Ya volveré a la escuela cuando Gustavo sea grande y pueda valerse por sí mismo,” fue la promesa que te hice y que, al fin, cumplí. Espero que eso te de algo de paz, incluso todos estos años después.

Hoy tengo veinticinco años, mamá. Veinticinco años bien vividos, quiero pensar. No todo ha sido perfecto—nunca nada lo es—pero he intentado ser el hombre que a ti y a papá les hubiera gustado que fuera, un hijo digno de ustedes, un hermano mayor digno de Gustavo. Me vine para El Paso, donde hay mucha de nuestra gente, y estudié en uno de sus community colleges. Aquí hay personas buenas que me han ayudado sin preguntarme nunca de dónde vine ni por qué, que me han dado trabajo y a las que quiero como si fueran de mi misma sangre. Tengo un hijo pequeño; se llama Gustavo, como mi hermanito, y todos los días me hace recordar el amor que siento por ustedes, incluso si ya no están. Pero tengo miedo, mamá, miedo de que algún día me pregunte qué fue lo pasó y por qué me fui de nuestra tierra. Tengo miedo de las palabras que diré entonces, como si de mi boca fueran a emerger los gritos de los que ardieron vivos, como si de entre mis lágrimas fueran a arrastrarse los muertos de aquella noche ensangrentada.

Todavía a veces sueño con ello. La oscuridad resuena con llantos y ruegos a los que solo responde la voz de las balas. Las llamas desgarran el manto de la noche y la sangre clama desde el suelo porque pare la matanza.

Soy como era entonces, un niño. Me escondo entre el pastizal mientras el miedo me estruja el corazón y quiero gritar, unirme al coro de voces sufrientes porque no sé dónde estás tú. Entre mis brazos, Gustavo me mira sin entender qué es lo que ocurre, y tengo que mantenerme sereno para que no comience a llorar y revele nuestro escondite. Pero de poco sirve, porque un hombre con el rostro cubierto por una máscara de diablo nos encuentra y lleva a rastras hasta el sitio donde han reunido a todo el pueblo, la plaza pública donde tantas veces hicimos asamblea y donde parece que ahora solo nos han juntado para morir.

El hombre de la máscara de diablo nos arroja al piso; al caer, protejo a Gustavo con mi cuerpo—todavía no ha llorado ni una vez. De entre la gente sales tú a rodearnos con tus brazos como si eso pudiera escudarnos del horror, de los gritos asustados que proclaman “¡Quieren el agua! ¡Vinieron por nuestra agua!”

Agua. Agua siempre ha habido aquí en abundancia, más de la que alguna vez necesitamos. La cuidamos, pues es la vida misma, pero jamás pensamos en guardarla toda para nosotros mismos; la compartimos siempre. Estos hombres con sus ametralladoras largas y sus máscaras perversas la quieren toda para sí; en ese entonces no lo entendía, pero ahora sí. La usarán para sembrar droga que exportar a los insaciables consumidores de más allá de la frontera y, cuando el imperio dirija su atención y su apetito hacia otros rumbos, la usarán para sembrar aguacates—el oro verde que se también se riega con sangre. No dejarán descansar la tierra; esta se marchitará bajo sus pies, pero a ellos poco les importará. Lo que importa son los verdes, los fajos gordos que no bastan nunca para satisfacer a nadie.

“¿Quién va a trabajar para nosotros?” Ladra burlón el hombre de la máscara de diablo. “¿Quién va a servirnos a cambio de vivir?”

Nadie contesta. ¿Qué vida sería aquella, si sólo cosecharíamos muerte?

El hombre de la máscara de diablo manda abrir el almacén donde guardamos la cosecha y nos lleva al interior a punta de pistola. La gente obedece como borregos que van al matadero. El miedo no los deja pensar con claridad y, antes de que siquiera se den cuenta, están todos encerrados, sin salida, sin esperanza alguna. Uno de los narcos enciende fuego, y en unos instantes el almacén es un infierno del que emergen los gritos de agonía de hombres, mujeres y niños. El olor a carne quemada es insoportable.

Solo nosotros permanecemos fuera. Solo nosotros estamos aún vivos, porque yaces a los pies del hombre de la máscara de diablo y ruegas, ruegas con la voz rota que dejen vivir a tus hijos—al pequeño Gustavo y a mí. El hombre de la máscara de diablo suelta una carcajada que más bien es un aullido, y los demás se unen a él en coro.

Es aquí donde despierto. Tengo el corazón en la garganta y los ojos llenos de lágrimas. Tratando de no despertar a mi esposa, me siento al filo de la cama y lloro en silencio. No necesito soñar lo que pasa después—lo recuerdo aún en a la luz del día.

El hombre de la máscara de diablo ríe y ríe hasta que te toma de los cabellos y te arrastra lejos de nosotros. Gustavo al fin llora como si anticipara lo que está por suceder. Sus bramidos se unen a los gritos de los moribundos, al rugir de las llamas y a las risas de los hombres sin nombre.

“Escoge,” ordena el hombre de la máscara de diablo. “Escoge cuál de tus hijos ha de vivir, mujer, o los corto en pedacitos a los dos y te los doy de comer.”

Lloras. Lloramos. La noche no es sino fuego, sangre y lágrimas. Puedo ver cómo tu rostro se retuerce con angustia, con el horror indescriptible de una madre obligada a tomar una decisión maldita e indecible. Entre sollozos tratas de implorar que te maten a ti, que nos dejen ir a ambos y tomen tu vida a cambio, pero el hombre de la máscara de diablo ladra una orden y otro de sus matones me pone un cuchillo en el cuello. Puedo sentir la hoja mordiendo mi piel, y un hilillo de sangre caliente baja hasta mi ropa.

“¡Escoge!”

Levantas una mano temblorosa. Tus ojos están llenos de un dolor como ningún otro, y señalas al fin. Señalas a Gustavo. Señalas a tu bebé.

El matón me suelta y arranca a Gustavo de mis brazos. Lo sujeta por los pies como si fuera un pollo del mercado y lo lleva ante el hombre de la máscara de diablo. Ambos ríen y, mientras tres hombres más te sujetan, azotan a Gustavo contra el suelo duro de la plaza. Sus gritos paran al instante, y tan solo eso parece ahora misericordia suficiente—mi hermano muere al primer golpe. Los hombres sin nombre, sin embargo, no paran hasta saciar su sed de sangre. Continúan azotando aquel cuerpo inerte y ya casi sin forma, aquella pequeña forma que alguna vez tuvo vida y nombre, pero que ahora no es sino un bulto ensangrentado. Gritas desesperadamente, como si todavía pudieras salvarlo, como si te estuvieran arrancando la piel y el alma, pero tu agonía no hace sino animarlos, y al terminar te arrojan el cadáver de Gustavo, a quien durante nueve meses llevaste con amor en tu vientre, a quien amaste con todo el corazón que tenías, a quien soñaste ver convertido en un hombre de bien.

“Entiérralo si quieres,” ríe el diablo. “Igual ya es comida para los gusanos.”

Los hombres sin nombre se van, dejándonos solos entre los muertos. Los gritos se han acallado al fin, y las flamas abaten poco a poco. Solo tus sollozos y los trinos de los grillos rompen el silencio. Yo no hago ruido alguno; estoy en shock, paralizado ante lo que acabo de presenciar. No puedo siquiera seguir llorando. Trato de ir hacia ti, de abrazarte, pero mis piernas no me responden—tan solo permanezco quieto, inmóvil como si yo mismo fuera un cadáver, como si la muerte de Gustavo me hubiera matado a mí también. Por eso no puedo consolarte. Por eso no puedo aligerar tu dolor. Por eso no puedo detenerte cuando, sin mirar atrás, caminas hacia el río que fluye en los linderos del pueblo y te sumerges en sus aguas. No gritas, no ruegas, no dices adiós. Simplemente te hundes con Gustavo en brazos y desapareces en las profundidades líquidas de esa noche dentro de una noche.

Entonces corro. Corro sin rumbo en la penumbra, dejando atrás huellas que se llenan de ceniza y polvo, que pronto no son más que un recuerdo borrado por la lluvia y el viento. Dejo atrás todo—el pueblo y sus muertos, el río y los ecos de aquellas risas perversas que nos robaron la vida y la esperanza.

Mamá, quiero que sepas que no te culpo por nada de lo que pasó. No sé por qué elegiste como elegiste, pero te entiendo. Entiendo que no quisiste dejarme solo, pero la agonía de tu decisión fue demasiada. A veces me pregunto si mi tacto habría bastado para que no te fueras tú también, pero sé en el fondo que de nada habría servido; lo que sucedió no fue culpa de nosotros, sino de quienes vinieron a sembrar muerte y sufrimiento entre nosotros. Si sientes aun culpa, te libero de ella—te perdono. Te amo más de lo que podría jamás culparte por dejarme solo; te amo más de lo que podría reprocharte tu decisión.

A veces el sueño es distinto, mamá, y no sueño aquella noche, sino una como esta. Sueño que sales del río con Gustavo, ambos hinchados y jadeantes, unidos en un abrazo inseparable. Te acuestas en el suelo y creces. Creces como crecen las montañas, poco a poco, cubriendo el pueblo con tu sombra hasta que este cruje bajo tu peso, devorándolo lentamente, centímetro a centímetro y casa por casa. Eres una avalancha que avanza lenta pero voraz, incapaz de detenerte hasta que todo yazca debajo de ti, dentro de ti. Pronto el pueblo no existe más, e incluso los hombres sin nombre que nos arrebataron todo gritan con terror e imploran piedad cuando ven aquello en lo que te has convertido, aquella masa imparable que los exprime hasta que revientan como uvas; ahora, su dinero y sus armas valen lo mismo que sus vidas—nada.

Pero no paras ahí. No te detienes. No puedes, ¿Verdad? Ya no eres más tú; eres un cuerpo sin mente, sin propósito más allá de seguir creciendo, expandiéndote y devorando. Solo te queda el odio, el dolor, aunque no recuerdes de dónde viene. Si me vieras, ¿Me reconocerías siquiera, o me devorarías también?

Yo sé que estás ahí dentro, mamá. Sé que tu alma yace en algún lugar de esta forma extraña y cruel en la que te has convertido. Puedo sentirla llorando, implorando ser liberada y llevada al descanso eterno. Puedo sentir cómo me llamas, y hoy he elegido responder. ¿Quién más debería liberarte, sino tu hijo leal, tu hijo que te ama incluso tras todo lo que ha ocurrido?

He rezado, mamá, y me han respondido. La Dama Pálida me habló en sueños. “Debes liberar a tu madre,” me dijo. “Yo separaré su alma de la forma corpórea que la aprisiona y la llevaré al amparo de mi misericordia a reunirse con tu hermano, pero debes ser tú quien la convenza de soltar su dolor y su incansable venganza. Ten cuidado en tu viaje, pues habrá aquellos que quieran detenerte—hombres ciegos e ignorantes, crueles y ambiciosos que añoran usar a tu madre aun en la muerte, doblarla a su voluntad y hacer de ella un instrumento con el cual causar todavía más dolor a este mundo. Confía solo en ti, solo en el amor que te guía. Yo estaré contigo, y no te desampararé mientras tu causa sea solo la paz de tu madre.”

Hoy emprendo el camino, mamá. Hoy regreso convertido en hombre a ponerle fin a la historia que otros quisieron escribir para nosotros, para liberarte y darte la paz que mereces. Hoy voy a casa, mamá. Hoy voy a ti.

Do you remember, Mamá, what the town used to be like? Small, yes, but full of life. In the rainy season, the green fields stretched beyond the horizon. The people's houses—white walls and red tiles—were like freckles on the face of the fertile land, and we were like ants working diligently from sunrise to sunset, harvesting the cornfield and herding cows and sheep. We had no more than that, but we were happy; the fruit of our labor was enough to know that we had been blessed, to remember that we should be grateful and never forget the sacrifices that our blood had made to get us a little tranquility in an ever more turbulent world.

I remember that in our house we had an avocado tree, big and leafy. You taught me to take care of it, to give it water and good soil, to pick its ripe fruit and to save the seeds. I once told you that with so many seeds we could plant a whole forest of avocados, and you laughed with the mischievousness of a mother who knows something her son does not. When I asked you, you said that the avocado sucks up all the water in the soil, and that's why it's not good to plant too much. “The other seedlings need water too,” you said. "You should always leave some for others, Jairo, and not abuse our boon. The earth is good to us, so we have to be good to it, and to those who also inhabit it."

That is how it always was for us. We did not harvest more than we should, for we let the earth rest and renew itself. When we had more than we could eat, we sold it in the market, trying to be fair with the price and not let ourselves be possessed by the evil of money. Sometimes there were quarrels, yes, fights between neighbors and even between families, but we never forgot who we were, where we had come from and that, until the very end, we would always be one people, one village.

There was also sadness, of course. When Papá died, we mourned him for five months. The nights without his jokes that only he laughed at were lonely, long and heavy with his absence. The stories he told us were like him, lifeless, like muffled echoes that we dared not repeat so as not to interrupt him in his eternal rest. Without him, we had to work twice as hard in the fields, giving ourselves body and soul to cultivating the soil. You never wanted me to abandon my studies to help you, but I was not going to leave all the work to you because Gustavo was still a little boy, and your protests found in me no other answer than the purest stubbornness. “I will go back to school when Gustavo is grown up and can fend for himself,” was the promise I made to you and which, at last, I kept. I hope that gives you some peace, even all these years later.

I'm twenty-five years old today, Mamá. Twenty-five years well lived, I'd like to think. Not everything has been perfect—nothing ever is—but I have tried to be the man you and Papá would have liked me to be, a son worthy of you, a big brother worthy of Gustavo. I came to El Paso, where there are many of our people, and I studied in one of their community colleges. There are good people here, people who have helped me without ever asking me where I came from or why, who have given me work and whom I love as if they were my own blood. I have a little son; his name is Gustavo, like my little brother, and every day he reminds me of the love I feel for you, even if you are no longer here. But I am afraid, Mamá, afraid that someday he will ask me what happened and why I left our land. I am afraid of the words I will say then, as if from my mouth will emerge the screams of those who burned alive, as if from my tears will crawl the dead of that bloody night.

I still sometimes dream about it. The darkness echoes with cries and pleas to which only the voice of the bullets responds. The flames tear apart the cloak of the night and the blood cries out from the ground for the slaughter to stop.

I am, as I was then, a child. I hide in the pasture while fear squeezes my heart and I want to scream, to join the chorus of suffering voices because I don't know where you are. In my arms, Gustavo looks at me without understanding what is happening, and I have to keep calm so that he does not start crying and reveal our hiding place. But it is of little use, because a man with his face covered by a devil mask finds us and drags us to the place where they have gathered the whole town, the public square where so many times we had assembled and where it seems that now they have only gathered us to die.

The man in the devil mask throws us to the ground; as we fall, I protect Gustavo with my body—he still hasn't cried once. You come out of the crowd to wrap your arms around us as if that could shield us from the horror, from the frightened screams that proclaim “They want the water! They came for our water!”

Water. Water has always been here in abundance, more than we ever needed. We take care of it, for it is life itself, but we never think of keeping it all for ourselves; we always share it. These men with their long guns and their wicked masks want it all for themselves; I didn't understand it then, but I do now. They will use it to grow drugs to export to the insatiable consumers beyond the border and, when the empire turns its attention and appetite elsewhere, they will use it to grow avocados—the green gold that is also watered with blood. They will not let the soil rest; it will wither under their feet, but they will care little for it. What matters are the greens, the fat bundles that are never enough to satisfy anyone.

“Who's going to work for us?” The man in the devil mask barks mockingly. “Who is going to serve us in exchange for their lives?”

No one answers. What life would that be, if we only reap death?
The man in the devil mask orders the warehouse where we store the harvest to be opened and pushes us inside at gunpoint. The people obey like sheep going to the slaughterhouse. Fear does not let them think clearly and, before they even realize it, they are all locked in, with no way out, no hope whatsoever. One of the narcos lights a fire, and in a few moments the warehouse is an inferno from which emerge the screams of agony of men, women and children. The smell of burning flesh is unbearable.

Only we remain outside. Only we are still alive, because you lie at the feet of the man in the devil mask and beg, beg with a broken voice for them to let your children live—little Gustavo and me. The man in the devil mask lets out a laugh that is more like a howl, and the others join him in chorus.

It is here that I wake up. My heart is in my throat and my eyes are full of tears. Trying not to wake my wife, I sit on the edge of the bed and cry silently. I don't need to dream what happens next—I remember it even in the daylight.

The man in the devil mask laughs and laughs until he grabs you by the hair and drags you away from us. Gustavo finally cries as if anticipating what is about to happen. His bellowing joins the screams of the dying, the roar of the flames and the laughter of the nameless men.

“Choose,” commands the man in the devil mask. “Choose which of your children is to live, woman, or I will cut them both to pieces and feed them to you.”

You cry. We cry. The night is nothing but fire, blood and tears. I can see your face contort with anguish, with the indescribable horror of a mother forced to make an accursed and unspeakable decision. Between sobs you try to plead for them to kill you, to let us both go and take your life in exchange, but the man in the devil mask barks an order and another of his thugs puts a knife to my throat. I can feel the blade biting into my skin, and a trickle of warm blood flows down to my clothes.

“Choose!”

You raise a trembling hand. Your eyes are filled with pain like no other, and you point at last. You point at Gustavo. You point at your baby.

The thug lets go of me and pulls Gustavo out of my arms. He holds him by his feet as if he were a market chicken and takes him to the man in the devil mask. They both laugh and, while three more men hold you down, they smash Gustavo against the hard floor of the square. His screams stop instantly, and that alone now seems like a mercy—my brother dies at the first hit. The nameless men, however, do not stop until their bloodlust is quenched. They continue smashing that inert and now almost formless body, that small shape that once had life and a name but is now nothing but a bloody lump. You scream desperately, as if you could still save him, as if they were tearing off your skin and soul, but your agony only encourages them, and when they finish they throw you the corpse of Gustavo, whom for nine months you carried with love in your womb, whom you loved with all the heart you had, whom you dreamed of seeing become a good man.

“Bury him if you want,” laughs the devil. “He's already food for the worms anyway.”

The nameless men depart, leaving us alone among the dead. The screams are silent at last, and the flames abate little by little. Only your sobs and the trills of crickets break the silence. I make no sound; I am in shock, paralyzed by what I have just witnessed. I can't even cry anymore. I try to go to you, to hug you, but my legs do not respond to me—I just remain still, motionless as if I were a corpse myself, as if Gustavo's death had killed me too. That is why I cannot console you. That is why I cannot lighten your pain. That is why I cannot stop you when, without looking back, you walk towards the river that flows at the edge of town and plunge into its waters. You don't scream, you don't beg, you don't say goodbye. You simply sink with Gustavo in your arms and disappear into the liquid depths of that night within a night.

Then I run. I run aimlessly in the gloom, leaving behind footprints that fill with ash and dust, soon nothing more than a memory erased by the rain and the wind. I leave everything behind—the town and its dead, the river and the echoes of that wicked laughter that robbed us of life and hope.

Mamá, I want you to know that I don't blame you for anything that happened. I don't know why you chose the way you did, but I understand. I understand that you didn't want to leave me alone, but the agony of your decision was too much. Sometimes I wonder if my touch would have been enough for you not to leave me, but I know deep down that it would have done no good; what happened was not our fault, but the fault of those who came to sow death and suffering among us. If you still feel guilt, I release you from it—I forgive you. I love you more than I could ever blame you for leaving me alone; I love you more than I could ever reproach you for your decision.

Sometimes the dream is different, Mamá, and I don't dream of that night, but of one like this. I dream that you come out of the river with Gustavo, both swollen and heaving, united in an inseparable embrace. You lie down on the ground, and you grow. You grow as the mountains grow, little by little, covering the town with your shadow until it creaks under your weight, slowly devouring it, centimeter by centimeter and house by house. You are an avalanche that advances slowly but voraciously, unable to stop until everything lies beneath you, inside you. Soon the people are no more, and even the nameless men who took everything from us scream in terror and beg for mercy when they see what you have become, that unstoppable mass that squeezes them until they burst like grapes; now, their money and their guns are worth the same as their lives—nothing.

But you don't stop there. You don't stop. You can't, can you? You are no longer you; you are a mindless body with no purpose beyond continuing to grow, expanding and devouring. All you have left is hate, pain, even if you don't remember where it comes from. If you saw me, would you even recognize me, or would you devour me too?

I know you're in there, Mamá. I know your soul lies somewhere in this strange, cruel form you've become. I can feel it crying, begging to be released and taken to eternal rest. I can feel you calling out to me, and today I have chosen to answer. Who else should release you, but your loyal son, your son who loves you even after all that has happened?

I have prayed, Mamá, and I have been answered. The Pale Lady spoke to me in a dream. “You must release your mother,” she said to me. "I will separate her soul from the corporeal form that imprisons her and take her under the shelter of my mercy to rejoin your brother, but you must be the one to convince her to release her pain and her tireless vengeance. Be careful on your journey, for there will be those who would stop you—blind and ignorant men, cruel and ambitious enemies who long to use your mother even in death, to bend her to their will and make her an instrument with which to inflict even more pain upon this world. Trust only in yourself, only in the love that guides you. I will be with you, and I will not forsake you as long as your cause is only your mother's peace."

Today I start my path, Mamá. Today I return as a man to put an end to the story that others sought to write for us, to free you and give you the peace you deserve. Today I come home, Mamá. Today I come to you.

Nahualismo

Aullido

Nuestro Señor Desollado